Abstract jds

NUROP Congress Paper
A Second Quorum Sensing Regulon in Burkholderia pseudomallei
Department of Biochemistry, Faculty of Science, National University of Singapore 10 Kent Ridge Road, Singapore 117597 ABSTRACT

Burkholderia pseudomallei, a Gram-negative soil bacterium, is the causative agent of melioidosis. Quorum sensing is a mechanism responsible for the regulated expression of
virulence genes in many bacterial pathogens. The first quorum sensing regulon in B.
pseudomallei, Ais/Air, was recently identified in our laboratory. The report describes the
identification of a second quorum sensing regulon, RhlI/RhlR, in B. pseudomallei. By data
mining of the recently completed B. pseudomallei K96243 genome sequence using homologous
sequences from related bacteria, we have found several putative quorum sensing genes in B.
pseudomallei. Gene-specific primers were designed to amplify the putative quorum sensing
genes, rhlI and rhlR. The primers included BamHI restriction sites to facilitate the cloning of
the PCR products into a broad host range mobilizable plasmid, pRK415. The PCR products
were sequenced to obtain the nucleotide sequences of the rhlI and rhlR genes B. pseudomallei
KHW, a clinical isolate. The translated amino acid sequences of the B. pseudomallei KHW RhlI
and RhlR proteins show high homology to the RhlI and RhlR proteins, respectively, of the P.
aeruginosa quorum sensing system.
INTRODUCTION

Burkholderia pseudomallei is the causative agent of melioidosis, a systemic and potential life -threatening disease in humans . The bacteriums is intrinsically resistant to many antibiotics and its mechanisms of virulence are still obscure. In this study, we aim to identify quorum sensing regulons in B. pseudomallei using a virulent locally isolated clinical strain, KHW. Quorum sensing is a two component gene regulation system, which controls cell density- dependent expression of diverse bacterial phenotypes. It consists of a N-acyl homoserine lactones (AHLs) autoinducer synthase, and an autoinducer regulator protein. Quorum sensing is known to regulate the production of virulence factors, motility, biofilm formation, plasmid transfer, and antibiotic resistance in several gram-negative bacterial pathogens (Lutter, et al, 2001). The strict control of virulence factor expression may be important in preventing the microorganism from alerting its host to its presence when infecting populations are small. As such, individual bacterial cells are essentially delayed from producing virulence factors until they are in a population (quorum) that is large enough to overwhelm the host (Whitehead, et al, 2001) Our laboratory has recently identified a pair quorum sensing genes in B. pseudomallei, which we called ais and air. Our studies with the ais deletion mutant of B. pseudomallei suggest 1 Student 2 Senior Lecturer (UROPS supervisor) that there may be additional quorum sensing regulons in B. pseudomallei. Moreover, in P.
aeruginosa, a closely related specie of B. pseudomallei, at least two pairs of quorum sensing
genes , lasI/lasR and rhlI/rhlR, are involved in the regulation of virulence (Whitehead, et al,
2001). This project describes the identification of a second pair of quorum sensing genes,
rhlI/rhlR, in B. pseudomallei.
RESULTS AND DISCUSSION
A. Bioinformatics research of the putative regions of the second pair of quorum sensing
genes of B. pseudomallei K96243 strain.
Pairwise alignment was performed using protein sequences of quorum sensing systems (luxI/R families) of related bacterial species as queries in a tblastn search against the B. pseudomallei K96243 genomic translated protein database at www.sanger.ac.uk. The results identified a region at nucleotide positions 2130000 ~ 2132100 on B. pseudomallei chromosome 2 which has high similarity (30-50%) to quorum sensing gene families , which includes the synthase and regulator genes. The putative quorum sensing genes were named rhlI and rhlR. Open Reading Frame predictions of the putative B. pseudomallei quorum sensing genes using Vector NTITM Suite 8 ORF analyses program, identified rhlI coding sequence at 2131287 ~ 2131895 and rhlR coding sequence at 2130282 ~ 2130974 on the B. pseudomallei K96243 chromosome 2. (Fig. 1) A putative promoter sequence, gccgctcttgcaatcgttattgc atttgatattatttgcaga caatt tca was identified (2130052 ~ 2130097) using the Neural Network Promoter Prediction at http://www.fruitfly.org/seq_tools/promoter.html. (Fig. 1.) Multiple amino acid sequences alignment of translated B. pseudomallei K96243 RhlI with other AHL synthase proteins, and RhlR with other AHL dependent transcriptional regulator proteins of related bacterial species showe d that there were conserved motifs within quorum sensing systems. This strongly suggests that the B. pseudomallei K96243 rhlI and rhlR sequences which we have identified are likely to be involved in quorum sensing. rhl R
rhl I

Fig. 1. The physical map of putative quorum sensing genes rhlI and rhlR (orange arrow) on B.
pseudomallei K96243 chromosome 2 (nucleotide positions 2130000 to 2132100). Green arrows
indicate the PCR primer pairs, rhlIF1/rhlIR1 and rhlRF1/rhlRR1. The putative promoter is
indicated by the dark red arrow.
B. Primers for PCR
Primer pairs, rhlIF1/rhlIR1 and rhlRF1/rhlRR1 were designed, using Vector NTITM Suite 8 Primer Design program, to inc lude BamHI restriction site s in the sense and antisense primers so as to facilitate the cloning of the rhlI and rhlR PCR products, respectively, into the broad host range, mobilizable vector, pRK415 (Fig. 1, Table 1). 2 nucleotides, GC, were added to the beginning of rhlRF1 and rhlIR1, to allow the cutting of the PCR product by BamHI. The primer stocks were dissolved with sterile distilled water and were diluted to 10 ìM before use. Table 1. Primers for the amplification and cloning of B. pseudomallei rhlI and rhlR. (BamHI restriction site is in bold) 5’- GCGGATCC TAGAGGAGAACGTCCAATTC -3’
5’- GCGGATCC CCGGGATAAAAATATCGAACGC -3’
rhlR R1 5’- ATGAAACGGGCGGCGCTAACGGAT -3’
C. PCR amplification of the B. pseudomallei KHW rhlI and rhlR
Polymerase chain reactions were done to amplify the full-length of rhlI and rhlR including their promoter region. B. pseudomallei KHW , a local clinic virulent strain was used as template. The reagents and the optimal PCR thermal cycle for rhlI and rhlR are listed in Table 2A, 2B. Table 1A. PCR mixture components of rhlI Table 1B. Optimal PCR thermal cycle for The size s of the PCR products obtained were as expected from the rhlI and rhlR sequences predicted (Fig.2). PCR products were extracted using BIO 101 GENECLEAN® SPIN kit according to the manufacturers instructions . agarose gel electrophoresis of rhlR (1024bp) obtained by PCR in buffer conta ining 1.0mM rhlR(1079bp) obtained by PCR in buffer
D. Cloning of rhlI and rhlR into vector pRK415
The plasmid vector, pRK415, and purified rhlI and rhlR PCR products were each digested with BamHI (1u/ì L) for 2 hours at 37°C. Linearized pRK415 was treated with CIAP (calf
intestinal alkaline phosphatase) to hydrolyze 5’-phosphate groups so as to prevent self-ligation
of the vector DNA. Ligation of pRK415 and rhlI or rhlR was performed using T4 DNA ligase
(0.3u/ ì L) at 16°C overnight. The ligation products were transformed into competent E. coli
DH5áëpir by electroporation at 1.8kV. Transformants were selected on LA agar containing
25 ì g/ml tetracycline, 0.01% (w/v) X-gal and 0.2mM IPTG.

E. DNA sequencing of B. pseudomallei KHW rhlI and rhlR
DNA sequencing of B. pseudomallei KHW rhlI and rhlR PCR products were performed using the ABI BigDye reagents and analyzed on an ABI377 automated DNA sequencer (Perkin-Elmer). rhlIF1/rhlIR1 and rhlRF1/rhlRR1 were used as sequencing primers. Sequence of B. pseudomallei KHW rhlI and rhlR were analyzed using Vector NT ITM ContigExpress program. Pairwise sequence alignment of the B. pseudomallei KHW rhlI and rhlR DNA sequences with that of B. pseudomallei K96243 showed that they share 97% and 99% similarity, respectively. Homology search of the translated B. pseudomallei KHW protein RhlI and RhlR against GenBank protein database using blastp identified several proteins which share high similarity (40-50%) with RhlI are N-acyl-homoserine lactone synthases, and high similarity (41-49%) with RhlR are acylhomoserine lactone dependent transcriptional regulators, respectively. The highest scores were those from Burkholderia spp. and Pseudomonas spp. , which are taxonomically closely related to B. pseudomallei. This strongly suggests that the rhlI and rhlR genes which we have identified comprise a second quorum sensing system in B. pseudomallei. REFERENCES
Barbara-Ann D. Conway, Vicnays Venu, David P. Speert “Biofilm Formation and Acyl
Homoserine Lactone production in the Burkholderia cepacia Complex” Journal of Bacteriology,
Oct. 2002, p. 5678-5685. Vol.184, No.20
E. Lutter, S. Lewenza, J.J. Dennis, M.B. Visser, P.A. Sokol “Distribution of Quorum-Sensing
Genes in the Burkholderia cepacia Complex” Infection and Immunity , July 2001, p. 4661-4666
Neil A. Whitehead, Anne M.L. Barnard, Holly Slater, Natalie J.L. Simpson, george P.C.
Salmond “Quorum-sensing in Gram-negative bacteria” FEMS Microbiology reviews 25 (2001)
365-404
Roger S. Smith, Sarah G. Harris, Richard Phipps, Barbara Iglewski “The Pseudomonas
aeruginosa Quorum-Sensing Molecule N-(3-Oxododecanoyl) Homoserine Lactone Contributes
to Virulence and Induces Inflammation in Vivo” Journal of Bacteriology, Feb. 2002, p. 1132-
1139. Vol.184, No.4

Source: http://www3.ntu.edu.sg/eee/urop/congress2003/Proceedings/abstract/NUS_FoS/Life%20Sciences/Jiang%20DonSheng.pdf