Variable number of tandem repeat polymorphisms of drd4: re-evaluation of selection hypothesis and analysis of association with schizophrenia

European Journal of Human Genetics (2009) 17, 793 – 801& 2009 Macmillan Publishers Limited All rights reserved 1018-4813/09 $32.00 Variable number of tandem repeat polymorphismsof DRD4: re-evaluation of selection hypothesis andanalysis of association with schizophrenia Eiji Hattori1,4, Mizuho Nakajima1,4, Kazuo Yamada1, Yoshimi Iwayama1, Tomoko Toyota1,Naruya Saitou2 and Takeo Yoshikawa*,1,3 1Laboratory for Molecular Psychiatry, RIKEN Brain Science Institute, Saitama, Japan; 2Division of Population Genetics,National Institute of Genetics, Shizuoka, Japan; 3CREST, Japan Science and Technology Agency, Tokyo, Japan Associations have been reported between the variable number of tandem repeat (VNTR) polymorphismsin the exon 3 of dopamine D4 receptor gene gene and multiple psychiatric illnesses/traits. We examinedthe distribution of VNTR alleles of different length in a Japanese cohort and found that, as reported earlier,the size of allele ‘7R’ was much rarer (0.5%) in Japanese than in Caucasian populations (B20%). Thispresents a challenge to an earlier proposed hypothesis that positive selection favoring the allele 7R hascontributed to its high frequency. To further address the issue of selection, we carried out sequencing ofthe VNTR region not only from human but also from chimpanzee samples, and made inference on theancestral repeat motif and haplotype by use of a phylogenetic analysis program. The most common 4Rvariant was considered to be the ancestral haplotype as earlier proposed. However, in a gene tree of VNTRconstructed on the basis of this inferred ancestral haplotype, the allele 7R had five descendent haplotypesin relatively long lineage, where genetic drift can have major influence. We also tested this lengthpolymorphism for association with schizophrenia, studying two Japanese sample sets (one with 570 casesand 570 controls, and the other with 124 pedigrees). No evidence of association between the allele 7R andschizophrenia was found in any of the two data sets. Collectively, this study suggests that the VNTRvariation does not have an effect large enough to cause either selection or a detectable association withschizophrenia in a study of samples of moderate size.
European Journal of Human Genetics (2009) 17, 793–801; published online 17 December 2008 Keywords: DRD4; VNTR; selection; phylogenetic network; schizophrenia disorder has remained elusive. The dopamine D4 receptor Disturbances in the dopamine neurotransmitter system have long been suggested to play a crucial role in the received considerable interest because clozapine, a neuro- pathogenesis of schizophrenia.However, involvement of leptic, which is often effective for treatment-resistant dopamine-related genes in the development of this symptoms, has a high affinity to this receptorAlso, D4receptor is upregulated in the postmortem brain tissuesfrom schizophrenic patients.To investigate genetic *Correspondence: Dr T Yoshikawa, Laboratory for Molecular Psychiatry,RIKEN Brain Science Institute, 2-1 Hirosawa, Wako-city, Saitama 351-0198, association of DRD4 with psychiatric phenotypes and Japan. Tel: þ 81 48 467 5968; Fax: þ 81 48 467 7462; traits, many studies have focused on a 48-bp variable number of tandem repeat (VNTR) in exon 3. This tandem 4The first two authors equally contributed to this work.
repeat varies in length, comprising two (2R) to eleven (11R) Received 5 August 2008; revised 6 October 2008; accepted 20 November2008; published online 17 December 2008 48-bp repeat units, and codes for the third intracellular DRD4: selection and association with schizophrenia loop of the receptor protein.The 7R variant protein has carried out using an ABI 9700 thermocycler (Applied functional properties distinct from other size variants in Biosystems, Foster City, CA). PCR fragments were analyzed terms of clozapine bindingand effect on post-synaptic on an ABI PRISM 3700 Genetic Analyzer (Applied Bio- intracellular signal transduction.Also, there has been systems) and the genotype, or the constitution of size alleles, growing literature reporting genetic association of the of each individual sample was determined using GeneScan allele 7R with psychiatric traits/illnesses including novelty 3.5.2 and Genotyper 3.6 software (Applied Biosystems).
Subsequently, the VNTR sequences of 102 human chromo- somes from control subjects as well as 20 chimpanzee declared association of the VNTR size polymorphisms (Pan troglodytes) chromosomes were determined. We with schizophrenia,although not all studies carried out subcloning of a PCR product encompassing the entire VNTR region using TOPO TA Cloning kit Also, supporting the functional role of the VNTR is (Invitrogen, Carlbad, CA) and subsequently direct sequen- evidence of selection favoring the allele 7R of the V cing using the DYEnamic ET terminator cycle sequencing It was shown that the ratio of non-synonymous (Ka) to kit (Amersham Biosciences, Piscataway, NJ) and the synonymous (Ks) substitutions, Ka/Ks, is higher than 1 in this ABI PRISM 3730 Genetic Analyzer (Applied Biosystems).
tandem repeat regions, and that strong linkage disequili- Sequences were aligned by the SEQUENCHER program brium (LD) exists between the allele 7R and the surrounding (Gene Codes Corporation, Ann Arbor, MI).
DRD4 polymorphisms. Further, on the basis of inferred gene The primer sequences and detailed information on the genealogy of VNTR alleles, the allele 7R was supposed to have reaction conditions are available upon request.
originated as a rare event involving multiple mutations andgene conversions. The observed high frequency of the allele 7R in many European ancestry populations despite a Phylogenetic networks of human and chimpanzee motifs complicated mechanism of its origin added support to the were constructed as earlier describedusing an in-house notion of selection and functional importance of the VNTR.
computer program. Possible unequal crossing-over and In the world-wide populations, 35 sequence variants of the nucleotide substitution events in the evolutionary history 48-bp repeat unit are known to exist, each of which is referred to as a ‘motif’. To date, 56 different VNTRhaplotypes, with each being composed of an unique combination of motifs, have been reported in humans.
For case-control association analysis, samples from 570 However, no study has ever exploited the data on sequence unrelated cases of schizophrenia (285 men, 285 women; variation both from human and chimpanzee samples for mean age 47.0±11.4 years), and 570 age- and sex-matched procedures of population genetics analysis.
controls (285 men, 285 women; mean age 46.7±11.1 In this study, we attempted to make precise inference on years) were analyzed.Furthermore, for family-based ancestral haplotype to construct a gene tree of VNTR by association test, we studied 124 pedigree sample sets with subcloning and sequencing both human and chimpanzee 376 members, of whom 163 were affected. This included 80 samples. We constructed a phylogenetic network of motifs independent and complete trios (schizophrenic offspring using an in-house computer program and inferred a and their parents), 15 probands with one parent, 13 possible genetic relationship of the VNTR haplotypes.
probands with affected siblings, and 30 probands with These analyses allowed us to re-evaluate the proposed discordant siblings.Probands consisted of 72 males and notion of selection acting on this gene locus. We also studied the VNTR for association with schizophrenia in The diagnosis of schizophrenia was made by consulta- Japanese case-control and pedigree sample sets.
tion according to DSM-IV criteria with consensus from at In this study, the term ‘allele’ means the length variant least two experienced psychiatrists. All available medical of VNTR. The same length does not necessarily reflect the records were taken into consideration. Control subjects same VNTR sequence as is shown in studies including this were recruited from hospital staffs and volunteers who one (see below in the Results section). A ‘motif’ refers to a showed no evidence of psychoses during brief interviews sequence variant of the 48-bp repeat unit of the VNTR.
with psychiatrists. All subjects were from central Japan.
Also, we mean a VNTR sequence or a motif composition by The study was approved by the Ethics Committee of RIKEN, and all participants provided written informedconsent.
Materials and methodsLength-analysis, subcoloning and re-sequencing of the In case-control analysis, the allelic and genotypic distribu- The VNTR locus was amplified by polymerase chain tions were tested for association by a Monte-Carlo reaction (PCR) using fluorescent-labeled primers. PCR was DRD4: selection and association with schizophreniaE Hattori et al simulations and the random number seed set to 10 000 and Supplementary Information), giving rise to three different 100, respectively). Fisher’s exact test was also performed to VNTR haplotypes One haplotype was novel but test each individual allele for association. In the analysis all of the seven constituent motifs were included in the of pedigree samples, transmission disequilibrium test was performed to test for global association and for individual To obtain more information on the sequence diversity around the VNTR, we subsequently studied a fraction of human and chimpanzee samples, and examined theadjacent two SNPs, rs1870723 (G/A) and rs7482904 (G/C)located at 165-bp and 185-bp downstream of the VNTR,respectively A haplotype, G – G, was in synteny with most VNTR haplotypes including the most common 4R (H1 – H2 – H3 – H4) haplotype, whereas G – C haplotype Seven length variants of the VNTR (2R, 3R, 4R, 4.5R, 5R, were found syntenic with all the 6R and 7R haplotypes.
6R, 7R) were detected We then carried out Another haplotype, A – C, was observed in majority of 2R subcloning for 102 human chromosomes so that all the haplotypes and one 4R (H1 – H2 – H13 – H4) haplotype. All size alleles can be sequenced. Eleven motifs and 14 VNTR the chromosomes from chimpanzee samples had the G – G haplotypes were identified and Supplementary Table S1 in Supplementary Information). We named thehuman motifs H1 to H35. Three haplotypes were newlyidentified in this study The frequency of the allele 7R in the Japanese cohort was extremely low (0.5%), Human and chimpanzee VNTR haplotypes are composed in contrast to that of world-wide average (19.2%) of various motifs (Supplementary Table S1 in Supplemen- The allele 4.5R was recently named so because tary Information) and their phylogenetic relationship of its size between 4 and 5 repeats.We identified this should be quite complex. The earlierand current studies length variant in eight chromosomes (four chromosomes detected a total of nine chimpanzee motifs, which we in each of cases and controls). We re-sequenced six of these designated as C1 to C9 (for the sequences of C8 and C9, see chromosomes, and it revealed an insertion of an 18-bp Supplementary Table S2 in Supplementary Information).
sequence, completely identical with the 30 immediate Among the human motifs, H1, H2, H3, and H4 were most downstream sequence of the VNTR into the middle portion frequent and thus are likely to have constituted an of the most common 4R haplotype We excluded ancestral haplotype. To further corroborate this inference, the possibility that the 4.5R may be an artifact that was we conducted a phylogenetic network analysis to reveal generated from the PCR and/or subcloning processes, relationships among these four human motifs and all the based on the results that allele compositions (eg genotypes) nine chimpanzee motifs. shows the phylogenetic in all the samples containing 4.5R allele were perfectly network for those 13 motifs. C1 and C2 differ by only one consistent between the results from GeneScan analysis and nucleotide, and they are closest to H1. C3, C4, C5, C8, and those from subcloning analysis. In addition, we did not C9 are similar with each other, and they are closest to H2.
detect any novel amplicons except for the 4.5R in all the Remaining two chimpanzee motifs (C6 and C7) differ by clones that we picked up and sequenced.
only one nucleotide, and they are closest to H4. There is no To add information for inference of an ancestral motif/ chimpanzee motif that is close to H3. Three black circles in indicate locations of common ancestral sequences analyzed by subcloning. Chimpanzee VNTRs from all the for human and chimpanzee, suggesting orthologous chromosomes were the same in size, each consisting of five relationships. It seems that the common ancestor of repeats of a 48-bp unit. There were seven sequence variants human and chimpanzee possessed a haplotype similar to (motifs) of a 48-bp unit (Supplementary Table S1 in H1 – H2 – H3 – H4. If this scenario is true, chimpanzee Distribution of the VNTR lengths in case (schizophrenia)-control samples VNTR, variable number of tandem repeat.
*P-value by Monte-Carlo test.
**P-value by Fisher’s exact test.
aN represents the number of chromosomes.
DRD4: selection and association with schizophrenia Motif compositions of the 48-bp VNTR haplotypes (human) H1 – H2 – H6 – H5 – H2 – H5 – H4 H1 – H2 – H13 – H5 – H2 – H5FH4c H1 – H2 – H27 – H5 – H2 – H5 – H4c VNTR, variable number of tandem repeat.
bThe 4.5R refers to an allele with a length between 4 and 5 repeats. See for details.
cNovel haplotypes identified in the present study.
CCCCGACGCCGTCAGAGCCGCCGCGCKCCCAACCCCAGACTCCACCGCAA CCCCGACGCCGTCAGAGCCGCCGCGCKCCCAACCCCAGACTCCACCGCAA The allele 4.5R of the VNTR. The 4.5R refers to an allele with a length between 4 and 5 repeats. Sequencing of this size allele revealed an insertion of an 18-bp sequence, completely identical with the sequence immediate 30 downstream sequence of the VNTR, to the most common 4Rhaplotype.
of most haplotypes can be accounted for by unequal crossing-over. For example, haplotypes H1 – H4, H1 – H2 –H4, H1 – H2 – H31, H1 – H11 – H4, and H1 – H2 – H3 – H2 – H3 – H4 can be generated from various kinds of unequal crossing-overs of the most frequent haplotype, H1 – H2 – H3 – H4 We have to assume a total of two nucleotide substitutions (shown with open triangles in one from haplotype H1 – H2 – H6 – H5 – H2 – H4 to C, chimpanzee motif; VNTR, variable number of tandem repeat.
H1 – H2 – H6 – H5 – H2 – H20 and another from H1 – H2 – H6 – A haplotype (C2 – C3 – C8 – C9 – C7) was earlier reported but not H5 – H2 – H5 – H4 to H1 – H2 – H27 – H5 – H2 – H5 – H4. Even aC1 – C9 represent motifs. See for detailed information on the complex transformation from haplotype H1 – H2 – H3 – H4 to H1 – H2 – H6 – H5 – H2 – H5 – H4 can be recon- bNovel haplotype identified in this study.
structed as six cycles of unequal crossing-overs should have lost the third motif during its evolution.
In the analysis of 570 cases and 570 controls, no significant When we examined chimpanzee haplotypes, order of association was found in the global distribution of the motifs were concordant with corresponding human 48-bp VNTR size alleles (P ¼ 0.166). Regarding motifs: C1 and C2 for H1, C3 – C5 for H2, and C6 and C7 individual haplotypes, the allele 3R, frequency of which was only 0.003 and 0.012 in cases and controls, respec- With the assumption of ‘H1 – H2 – H3 – H4’ being the tively, was significant (P ¼ 0.012) by Fisher’s exact test. The ancestral haplotype, we constructed a genetic relationship comparison between the allele 7R and all the other alleles of haplotypes of the human VNTR Derivation in the case-control samples gave an insignificant result DRD4: selection and association with schizophreniaE Hattori et al Haplotypes of the 48-bp VNTR and adjacent two SNPs (human) H1 – H2 – H6 – H5 – H2 – H5 – H4 H1 – H2 – H13 – H5 – H2 – H5 – H4 VNTR, variable number of tandem repeat.
aNumbers represent motifs. See for detailed information on motif sequences.
bSNPs rs1870723 and rs7482904 are 165-bp and 185-bp downstream of the VNTR, respectively.
cThe 4.5R refers to an allele with a length between 4 and 5 repeats. See for details.
In this study of DRD4, we particularly focused on the VNTRin exon 3 in terms of documented evidence of selective sweep acting on the allele 7R of the VNTR. It is proposed that the allele 7R was originated as a rare event involving both mutations and gene conversions and prevailed rapidly by positive However, the allele 7Rwas found very rare (0.5%) in our Japanese samples, andthis agreed with an earlier report.This low frequency of the allele 7R was also observed in Chinese popu- Also, the allele 7R of an African population was reported to have an intermediate frequency of 0.21.
This implies lack of selective sweep at this locus at least in Asian population history. Therefore, we further studied the entire VNTR region by re-sequencing both the Japanese The most common 4R (H1 – H2 – H3 – H4) was considered ancestral haplotype, as three of the constituent motifs werefound connected to chimpanzee motif clusters and the order of motifs of this haplotype is consistent with Phylogenetic network for human and chimpanzee motifs.
that of chimpanzee. Although 4R (H1 – H2 – H3 – H4) was Motifs H1 – H4 and C1 – C9 are from human and chimpanzee samples, postulated to be ancestral haplotype earlier based on the respectively. See and Supplementary Table S1 for detailed human motif frequencies,the current study is first to information on motif sequences. Black circles designate possible nodesof common ancestor for human and chimpanzee lineages. Numbers provide support for this inference by phylogenetic analysis on lines are nucleotide site positions, and those with asterisks indicate parallel changes. C1 and C2 differ by only one nucleotide, and they are closest to H1. C3, C4, C5, C8, and C9 are similar with each other, and A two-SNP haplotype ‘rs1870723G – 7482904G’, which is they are closest to H2. Remaining two chimpanzee motifs (C6 and C7)differ by only one nucleotide, and they are closest to H4. There is no in synteny with the most common 4R (H1 – H2 – H3 – H4) chimpanzee motif that is close to H3.
VNTR, is considered to constitute the distal part of theancestral (P ¼ 0.163) Evidence of association was not found but the intermediate ones (‘rs1870723G – 7482904C’ and in the analysis of 124 pedigrees with schizophrenic ‘rs1870723A – 7482904G’) were missing in the earlier offspring (global P ¼ 0.506). None of the individual alleles studies. This study detected an intermediate haplotype were significant and the allele 7R was not observed in this ‘rs1870723G – 7482904C’ attached to multiple VNTR haplo- types. For this G – C haplotype to be present, either a DRD4: selection and association with schizophrenia A possible genetic relationship of haplotypes of the human VNTR. (a) Possible transformation from haplotype 1 – 2 – 3 – 4 to 1 – 2 – 6 – 5 – 2 – 5 – 4. Unequal crossing-over events and nucleotide substitutions are indicated by black circles and open triangles, respectively. Arrows indicatedirection of changes. Estimated patterns of unequal crossing-over are shown next to product of crossing-overs. The asterisks point to recombinationwithin motifs, which give rise to new motifs. (b) Presumed pathways of how the 7R allele can be generated from the 4R allele with possibleintermediate haplotypes. The prefix ‘H’ for each motif is omitted.
nucleotide substitution or a recombination in the very From the VNTR haplotype data, the most frequent 7R short genomic interval between these two sites (20-bp (H1 – H2 – H6 – H5 – H2 – H5 – H4) haplotype can be generated by only six unequal crossing-overs. Five descendent DRD4: selection and association with schizophreniaE Hattori et al Transmission disequilibrium test for the VNTR in of promoter variants of this gene in the development of schizophrenia.Promoter variant and VNTR size allelesare in LD both in our Japanese samples (data not shown) and in world-wide populations.Documented associa- tions of the VNTR with ADHD and with other psychiatric traits may reflect LD between VNTR alleles and promoter There are limitations in this study. First, as DRD4 VNTR is a complex repeat polymorphism involving historicalrecombinations and was not subject to rigorous statistical Abbreviation: VNTR, variable number of tandem repeat.
*P-value for individual alleles was calculated by FBAT program.
tests for selection, although this problem is shared by all **Global P-value was calculated by PDT program.
studies on the same subject. Second, our associationanalysis is based on a case-control design, where bothfalse-positive and false-negative results can be produced.
Though our analysis of the same sample set using haplotypes (1 – 2 – 13 – 5 – 2 – 5 – 4, 1 – 2 – 13 – 4, 1 – 2 – 27 – 5 – STRUCTURE softwaredetected no evidence of popula- 2 – 5 – 4, 1 – 2 – 6 – 5 – 2 – 4, and 1 – 2 – 6 – 5 – 2 – 20 in tion stratification.Third, the sample size in the associa- were thought to have been derived from this 7R haplotype.
tion study is obviously limited. When the genotypic Our sequence data on rs1870723 and rs7482904 revealed relative risk is set to 1.2 with the multiplicative model, the prevalence of the intermediate two-SNP haplotype the current size of case-control samples had a power of attached exclusively to this common 7R and its descen- detecting 0.313 and 0.360 at the threshold of P ¼ 0.05 even dants. Thus the lineage downstream of the most frequent for common size alleles 2R and 4R, respectivelyCon- 7R (H1 – H2 – H6 – H5 – H2 – H5 – H4) is thought to be long versely, to gain the power of 0.8 for detecting a risk allele enough to add diversity to the sequence around the VNTR.
with the same relative risk, the sample size would need to Thus our findings do not agree with earlier documented be 2100 cases and 2100 controls for the allele 2R, and 1700 lines of evidence for selection favoring for the allele 7R, cases and the 1700 controls for the allele 4R.Fourth, in which claim complexity of its generation involving multi- association analysis, alleles were coded according to their ple mutations and gene conversions and its high preva- lengths. This introduces loss of information on sequence lence despite short We, therefore, argue that the diversity, because even the same size allele is known to drastic difference in the frequency of the allele 7R among have multiple variants according to its constituent motifs.
populations may well be a consequence of random genetic This sample size would not have power to detect associa- drift. The possibility of balancing selection or different tion of each VNTR haplotype, many of which have low selective forces acting on different populations cannot completely be ruled out. In the case of the angiotensinogengene (AGT) polymorphism, this idea was supported bysupposedly varying degree of physical advantages of water-retention in different geographical conditions.It maybe, however, difficult to formulate population-specific AcknowledgementsWe are grateful to all the patients and their families who participated advantages for a specific psychiatric trait that the DRD4 in this study. This study was supported by RIKEN BSI Funds, Grant-in- aid for scientific studies from the MEXT of Japan to NS and EH, We further investigated this region for association with NARSAD Young Investigator Award to EH, and CREST funds from the schizophrenia. No evidence of global association was Japan Science and Technology Agency, Japan to TY. We wish to thank found between the 48-bp alleles of VNTR and the disease.
the members of the Research Resource Center at the RIKEN Brain The allele 3R showed significant under-representation in Science Institute for sequencing and genotyping services.
cases than in controls. This allele, however, was observedin only 14 chromosomes (1.2%) in controls. The possibilityof the allele 3R being true protective variant for only asmall fraction of subjects cannot be excluded, although this apparent association of a rare allele may be because of 1 Prasad S, Semwal P, Deshpande S, Bhatia T, Nimgaonkar VL, Thelma BK: Molecular genetics of schizophrenia: past, present population stratification. Association of DRD4 VNTR with and future. J Biosci 2002; 27: 35 – 52.
schizophrenia has not been consistently shown in the 2 Petronis A, Van Tol HH, Lichter JB, Livak KJ, Kennedy JL: The D4 earlier studies. Although a role of this polymorphism in dopamine receptor gene maps on 11p proximal to HRAS.
female schizophrenia was not be excluded by a meta- 3 Gelernter J, Kennedy JL, Van Tol HH, Civelli O, Kidd KK: The D4 analysis,our data provided no evidence of gender- dopamine receptor (DRD4) maps to distal 11p close to HRAS.
specific association. Earlier, we suggested a possible role DRD4: selection and association with schizophrenia 4 Sanyal S, Van Tol HH: Review the role of dopamine D4 receptors 24 Hwu HG, Hong CJ, Lee YL, Lee PC, Lee SF: Dopamine D4 receptor in schizophrenia and antipsychotic action. J Psychiatr Res 1997; gene polymorphisms and neuroleptic response in schizophrenia.
Biol Psychiatry 1998; 44: 483 – 487.
5 Van Tol HH, Bunzow JR, Guan HC et al: Cloning of the gene for a 25 Kohn Y, Ebstein RP, Heresco-Levy U et al: Dopamine D4 receptor human dopamine D4 receptor with high affinity for the gene polymorphisms: relation to ethnicity, no association with antipsychotic clozapine. Nature 1991; 350: 610 – 614.
schizophrenia and response to clozapine in Israeli subjects. Eur 6 Stefanis NC, Bresnick JN, Kerwin RW, Schofield WN, McAllister G: Neuropsychopharmacol 1997; 7: 39 – 43.
26 Hong CJ, Lee YL, Sim CB, Hwu HG: Dopamine D4 receptor mortem schizophrenic brain. Brain Res Mol Brain Res 1998; 53: variants in Chinese sporadic and familial schizophrenics. Am J 7 Sumiyoshi T, Stockmeier CA, Overholser JC, Thompson PA, 27 Weiss J, Magert HJ, Cieslak A, Forssmann WG: Association Meltzer HY: Dopamine D4 receptors and effects of guanine between different psychotic disorders and the DRD4 polymorph- nucleotides on [3H]raclopride binding in postmortem caudate ism, but no differences in the main ligand binding region of the nucleus of subjects with schizophrenia or major depression. Brain DRD4 receptor protein compared to controls. Eur J Med Res 1996; 8 Murray AM, Hyde TM, Knable MB et al: Distribution of putative 28 Petronis A, Macciardi F, Athanassiades A et al: Association study D4 dopamine receptors in postmortem striatum from patients between the dopamine D4 receptor gene and schizophrenia. Am J with schizophrenia. J Neurosci 1995; 15: 2186 – 2191.
9 Seeman P, Guan HC, Van Tol HH: Dopamine D4 receptors 29 Daniels J, Williams J, Mant R, Asherson P, McGuffin P, Owen MJ: elevated in schizophrenia. Nature 1993; 365: 441 – 445.
Repeat length variation in the dopamine D4 receptor gene shows 10 Van Tol HH, Wu CM, Guan HC et al: Multiple dopamine D4 no evidence of association with schizophrenia. Am J Med Genet receptor variants in the human population. Nature 1992; 358: 30 Sommer SS, Lind TJ, Heston LL, Sobell JL: Dopamine D4 receptor 11 Schoots O, Van Tol HH: The human dopamine D4 receptor repeat variants in unrelated schizophrenic cases and controls. Am J Med sequences modulate expression. Pharmacogenomics J 2003; 3: 31 Nanko S, Hattori M, Ikeda K, Sasaki T, Kazamatsuri H, Kuwata S: 12 Asghari V, Sanyal S, Buchwaldt S, Paterson A, Jovanovic V, Van Tol Dopamine D4 receptor polymorphism and schizophrenia. Lancet HH: Modulation of intracellular cyclic AMP levels by different human dopamine D4 receptor variants. J Neurochem 1995; 65: 32 Iwata Y, Matsumoto H, Minabe Y et al: Early-onset schizophrenia and dopamine-related gene polymorphism. Am J Med Genet B 13 Jonsson E, Brene S, Geijer T et al: A search for association between Neuropsychiatr Genet 2003; 116: 23 – 26.
schizophrenia and dopamine-related alleles. Eur Arch Psychiatry 33 Tanaka T, Igarashi S, Onodera O et al: Lack of association between Clin Neurosci 1996; 246: 297 – 304.
dopamine D4 receptor gene and schizophrenia. Am J Med Genet 14 Ebstein RP, Novick O, Umansky R et al: Dopamine D4 receptor (D4DR) exon III polymorphism associated with the 34 Wang E, Ding YC, Flodman P et al: The genetic architecture of human personality trait of Novelty Seeking. Nat Genet 1996; 12: selection at the human dopamine receptor D4 (DRD4) gene locus. Am J Hum Genet 2004; 74: 931 – 944.
15 Faraone SV, Doyle AE, Mick E, Biederman J: Meta-analysis of the 35 Ding YC, Chi HC, Grady DL et al: Evidence of positive selection association between the 7-repeat allele of the dopamine D(4) acting at the human dopamine receptor D4 gene locus. Proc Natl receptor gene and attention deficit hyperactivity disorder. Am J Psychiatry 2001; 158: 1052 – 1057.
36 Bandelt HJ: Phylogenetic networks. Verh Naturewiss Ver Hamburg 16 LaHoste GJ, Swanson JM, Wigal SB et al: Dopamine D4 receptor gene polymorphism is associated with attention deficit hyper- 37 Saitou N, Yamamoto F: Evolution of primate ABO blood activity disorder. Mol Psychiatry 1996; 1: 121 – 124.
group genes and their homologous genes. Mol Biol Evol 1997; 17 Sanak M, Zelek-Molik A, Nalepa I, Wegrzyn J, Wciorka J: The dopamine D4 receptor VNTR in Polish schizophrenia patients.
38 Shimizu H, Iwayama Y, Yamada K et al: Genetic and expression Schizophr Res 2005; 73: 129 – 131.
analyses of the STOP (MAP6) gene in schizophrenia. Schizophr Res 18 Ambrosio AM, Kennedy JL, Macciardi F et al: No evidence of association or linkage disequilibrium between polymorphisms in 39 Aoki-Suzuki M, Yamada K, Meerabux J et al: A family-based the 50 upstream and coding regions of the dopamine D4 receptor association study and gene expression analyses of netrin-G1 gene and schizophrenia in a Portuguese population. Am J Med and -G2 genes in schizophrenia. Biol Psychiatry 2005; 57: Genet B Neuropsychiatr Genet 2004; 125: 20 – 24.
19 Segman RH, Goltser T, Heresco-Levy U et al: Association of 40 Sham PC, Curtis D: Monte Carlo tests for associations between dopaminergic and serotonergic genes with tardive dyskinesia in disease and alleles at highly polymorphic loci. Ann Hum Genet patients with chronic schizophrenia. Pharmacogenomics J 2003; 3: 41 Martin ER, Monks SA, Warren LL, Kaplan NL: A test for linkage 20 Tang Y, Wang Y, Cai Z: [Schizophrenia and dopamine D4 gene and association in general pedigrees: the pedigree disequilibrium polymorphism in Chinese population: association analysis].
test. Am J Hum Genet 2000; 67: 146 – 154.
Zhonghua Yi Xue Za Zhi 2001; 81: 995 – 998.
42 Kim YS, Leventhal BL, Kim SJ et al: Family-based association study 21 Serretti A, Lilli R, Lorenzi C, Lattuada E, Smeraldi E: DRD4 exon 3 of DAT1 and DRD4 polymorphism in Korean children with variants associated with delusional symptomatology in major ADHD. Neurosci Lett 2005; 390: 176 – 181.
psychoses: a study on 2,011 affected subjects. Am J Med Genet 43 Livak KJ, Rogers J, Lichter JB: Variability of dopamine D4 receptor (DRD4) gene sequence within and among nonhuman primate 22 Kaiser R, Konneker M, Henneken M et al: Dopamine D4 receptor species. Proc Natl Acad Sci USA 1995; 92: 427 – 431.
48-bp repeat polymorphism: no association with response to 44 Gelernter J, Kranzler H, Coccaro E, Siever L, New A, Mulgrew CL: antipsychotic treatment, but association with catatonic schizo- D4 dopamine-receptor (DRD4) alleles and novelty seeking in phrenia. Mol Psychiatry 2000; 5: 418 – 424.
substance-dependent, personality-disorder, and control subjects.
23 Serretti A, Lilli R, Di Bella D et al: Dopamine receptor D4 gene is Am J Hum Genet 1997; 61: 1144 – 1152.
not associated with major psychoses. Am J Med Genet 1999; 88: 45 Nakajima T, Wooding S, Sakagami T et al: Natural selection and population history in the human angiotensinogen gene (AGT): DRD4: selection and association with schizophreniaE Hattori et al 736 complete AGT sequences in chromosomes from around the DRD4 gene in Japanese schizophrenics. J Hum Genet 2007; 52: world. Am J Hum Genet 2004; 74: 898 – 916.
46 Glatt SJ, Faraone SV, Tsuang MT: Schizophrenia is not 48 Pritchard JK, Stephens M, Donnelly P: Inference of population associated with DRD4 48-base-pair-repeat length or indi- structure using multilocus genotype data. Genetics 2000; 155: vidual alleles: results of a meta-analysis. Biol Psychiatry 2003; 49 Purcell S, Cherny SS, Sham PC: Genetic Power Calculator: design 47 Nakajima M, Hattori E, Yamada K et al: Association and of linkage and association genetic mapping studies of complex synergistic interaction between promoter variants of the traits. Bioinformatics 2003; 19: 149 – 150.
Supplementary Information accompanies the paper on European Journal of Human Genetics website

Source: http://sayer.lab.nig.ac.jp/~saitou/paper-pdf/Hattori_EJHG09.pdf